View previous topic | View next topic

Humans 35% Daffodil?

Page 1 of 2
Goto page 1, 2  Next

Matt McGinty
34604.  Fri Nov 25, 2005 8:10 pm Reply with quote

Could someone please explain to me Stephen's comment when discussing chromosomes? He suggested as we compare ourselves to apes we could also say we humans are 35% daffodil. I'm struggling to fathom the calculations that went behind this. Also I thought the custard explosion formula was reamrkably similar to photosynthesis, does this make me an idiot?

Thanks and keep up the good work,

Matt

 
Flash
34606.  Fri Nov 25, 2005 8:19 pm Reply with quote

Photosynthesis is nCO2 + 2nH2O + light energy → (CH2O)n + nO2 + nH2O

whereas the custard explosion (strictly, the oxidation of glucose) is C6H12O6(s) + 6O2(g) --> 6CO2(g) + 6H2O(g)

(we can't seem to manage sub- and super-scripts on this board).

but that doesn't make you an idiot. No-one who is 35% daffodil could be entirely idiotic (you have 35% of your DNA in common with them, you see).

 
JumpingJack
34607.  Fri Nov 25, 2005 8:24 pm Reply with quote

Hi Matt,

The information was drawn from an excellent recent book What It Means To Be 98% Chimpanzee by Jonathan Marks (University of California Press, 2002) which cannot be recommended too highly.

Some fascinating (annotated) insights from it include:

It’s often stated that chimpanzees are over 98% genetically the same as human beings, though there is no agreement on the precise figure. Different studies come up with different percentages. Disgracefully, the stated figure can even vary within the same book. The Great Ape Project:Equality Beyond Humanity(edited by Paola Cavalieri and Peter Singer (St Martin’s Press (1994) variously gives it as both ‘within 1%’ and ‘1.6%’.

In any case, this modern cliché is meaningless for a number of reasons.

One is that percentages are linear and animals are three dimensional (four, if you count growth). It’s impossible to say, percentagewise, whether a large sphere is more similar to a small sphere or a large cube. A second is the universally agreed assumption that the vast majority of DNA be written off as ‘junk’ that serves no purpose – when it may in fact be that we do not yet understand what its purpose is. A third reason is that percentage differences depend on how even ‘simple’ linear information is presented.

The following are sequences of 20 DNA bases from the same regions of a baboon’s and an orang-utan’s genome respectively:

CCTTGGGCCTCCCGCCAGGC
CCTTGGGCTCCCGCCAGGCC

Presented this way it looks at first sight as if there are 7 differences out of twenty – rather a high proportion. But if the same information is presented in a slightly different way most of the differences completely disappear:

CCTTGGGCCTCCCGCCAGGC
CCTTGGG CTCCCGCCAGGCC

There are now no differences in either the number or order of the bases. Does the gap count as one difference, or as two – given that the ‘C’ has to both come out of the gap and be tacked onto the end?

Most genetic comparisons are much more complicated than this simple example.

Although human DNA contains approximately 3.2 billion letters, every single one of them (like the DNA of all livings things) is one of just four subunits AGC and T (adenine, guanine, cytosine and thymine). Statistically, therefore, no living thing can be less than 25% similar to any other – even if they have no apparent similarities whatsoever. DNA comparisons therefore overestimate similarity at the low end (25% being the zero mark) and underestimate it at the high end.

A human being is thus about 35% similar to a daffodil (ie not very similar at all) and, expressed in this way, the idea that humans are 98.5% similar to a chimpanzee seems a lot less remarkable.

To say that a human being is over one third daffodil, however, is of course fatuous. There are almost no meanigful comparisons at all.

 
samivel
34624.  Sat Nov 26, 2005 12:01 am Reply with quote

So, using that percentage comparison, you could say that human beings are 25% similar to any living thing?

 
JumpingJack
34625.  Sat Nov 26, 2005 2:41 am Reply with quote

Yes, samivel. At least 25%.

 
Mostly Harmless
34638.  Sat Nov 26, 2005 4:14 am Reply with quote

..


Last edited by Mostly Harmless on Mon Jan 09, 2006 6:49 am; edited 1 time in total

 
Celebaelin
34641.  Sat Nov 26, 2005 4:30 am Reply with quote

It don't think it got mentioned on air in the end but the diploid number of sheep (and goats) is 54.

 
JumpingJack
34648.  Sat Nov 26, 2005 4:47 am Reply with quote

Thanks, Celebailin, we'll add that to our collection.

And thanks, Mostly, for 'chromomemes' – I didn't know that either.
May I have a source for that lovely chart so I can enterht e info in the QIDb?

 
Mostly Harmless
34652.  Sat Nov 26, 2005 4:54 am Reply with quote

..


Last edited by Mostly Harmless on Mon Jan 09, 2006 6:49 am; edited 1 time in total

 
JumpingJack
34686.  Sat Nov 26, 2005 5:54 am Reply with quote

Many thanks.

 
djgordy
34689.  Sat Nov 26, 2005 6:01 am Reply with quote

I quite liked the idea of being 35% daffodil.

 
samivel
34791.  Sat Nov 26, 2005 8:26 am Reply with quote

I like the sound of a QIDb - is it available to all?

 
JumpingJack
34861.  Sat Nov 26, 2005 10:57 am Reply with quote

It is not, samivel, but we are working away behind the wainscoting (wainscotting?) to knock it into some proper shape.

It's not really a Db at the moment, but a large number of lists of interesting information.

One day, one day...

 
Jenny
35019.  Sat Nov 26, 2005 2:17 pm Reply with quote

I liked the idea of being 35% daffodil too. I was just practising fluttering and dancing in the breeze when Jack shot the bulb out from under me. Bah!

 
Matt McGinty
35106.  Sat Nov 26, 2005 3:35 pm Reply with quote

Thanks for all your feedback guys, most enlightening.

 

Page 1 of 2
Goto page 1, 2  Next

All times are GMT - 5 Hours


Display posts from previous:   

Search Search Forums

Powered by phpBB © 2001, 2002 phpBB Group